blastn blastn 2.2.17 [Aug-26-2007] ~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402. /home/sbassi/bioinfo/data/ecoli.nt lcl|1_0 Coso1 525 10 1 -3 5 2 F 1 lcl|1_0 Coso1 525 1 gi|2367346|gb|AE000481.1|AE000481 Escherichia coli K-12 MG1655 section 371 of 400 of the complete genome AE000481 12968 1 34.1929 17 0.120677 394 378 1023 1039 1 -1 17 17 17 CGGTGGCCCGGCGGTGC CGGTGGCCCGGCGGTGC ||||||||||||||||| 2 gi|2367291|gb|AE000456.1|AE000456 Escherichia coli K-12 MG1655 section 346 of 400 of the complete genome AE000456 11568 1 30.2282 15 1.88418 229 215 8347 8361 1 -1 15 15 15 TGCGTGTGGATCGCG TGCGTGTGGATCGCG ||||||||||||||| 3 gi|1789868|gb|AE000422.1|AE000422 Escherichia coli K-12 MG1655 section 312 of 400 of the complete genome AE000422 10864 1 30.2282 15 1.88418 8 22 4417 4431 1 1 15 15 15 CGCGGGCAATGCCAA CGCGGGCAATGCCAA ||||||||||||||| 4 gi|2367149|gb|AE000354.1|AE000354 Escherichia coli K-12 MG1655 section 244 of 400 of the complete genome AE000354 10404 1 30.2282 15 1.88418 241 259 9298 9316 1 1 18 18 19 ACAACGGGCATCGCCAACG ACAACGGTCATCGCCAACG ||||||| ||||||||||| 5 gi|1788763|gb|AE000330.1|AE000330 Escherichia coli K-12 MG1655 section 220 of 400 of the complete genome AE000330 10892 1 30.2282 15 1.88418 134 116 8541 8559 1 -1 18 18 19 TCGTGAACGCTCGTCCGGT TCGTGAACGCTCATCCGGT |||||||||||| |||||| 6 gi|1788498|gb|AE000307.1|AE000307 Escherichia coli K-12 MG1655 section 197 of 400 of the complete genome AE000307 10691 1 30.2282 15 1.88418 445 431 6547 6561 1 -1 15 15 15 CAGGCCATCGCCGCC CAGGCCATCGCCGCC ||||||||||||||| 7 gi|1787966|gb|AE000263.1|AE000263 Escherichia coli K-12 MG1655 section 153 of 400 of the complete genome AE000263 11684 1 30.2282 15 1.88418 369 355 1936 1950 1 -1 15 15 15 GCCGCATCGCTGTCG GCCGCATCGCTGTCG ||||||||||||||| 8 gi|1787888|gb|AE000256.1|AE000256 Escherichia coli K-12 MG1655 section 146 of 400 of the complete genome AE000256 10423 1 30.2282 15 1.88418 270 256 7051 7065 1 -1 15 15 15 ATGTGCAGCACCGTT ATGTGCAGCACCGTT ||||||||||||||| 9 gi|2367375|gb|AE000505.1|AE000505 Escherichia coli K-12 MG1655 section 395 of 400 of the complete genome AE000505 12921 1 28.2458 14 7.44509 236 223 8442 8455 1 -1 14 14 14 GAAATCCTGCGTGT GAAATCCTGCGTGT |||||||||||||| 10 gi|1790732|gb|AE000499.1|AE000499 Escherichia coli K-12 MG1655 section 389 of 400 of the complete genome AE000499 10244 1 28.2458 14 7.44509 454 441 9973 9986 1 -1 14 14 14 GCCGCGCGTCAGGC GCCGCGCGTCAGGC |||||||||||||| 11 gi|1790607|gb|AE000489.1|AE000489 Escherichia coli K-12 MG1655 section 379 of 400 of the complete genome AE000489 12088 1 28.2458 14 7.44509 429 442 1994 2007 1 1 14 14 14 ACGGCGGCGATGGC ACGGCGGCGATGGC |||||||||||||| 12 gi|2367349|gb|AE000482.1|AE000482 Escherichia coli K-12 MG1655 section 372 of 400 of the complete genome AE000482 20906 1 28.2458 14 7.44509 424 437 17124 17137 1 1 14 14 14 GGCGCACGGCGGCG GGCGCACGGCGGCG |||||||||||||| 13 gi|2367336|gb|AE000473.1|AE000473 Escherichia coli K-12 MG1655 section 363 of 400 of the complete genome AE000473 18290 1 28.2458 14 7.44509 448 461 3229 3242 1 1 14 14 14 GCGCGGCGCAACGC GCGCGGCGCAACGC |||||||||||||| 14 gi|2367315|gb|AE000460.1|AE000460 Escherichia coli K-12 MG1655 section 350 of 400 of the complete genome AE000460 10190 1 28.2458 14 7.44509 413 400 1292 1305 1 -1 14 14 14 CAGCGCCGCGTTAC CAGCGCCGCGTTAC |||||||||||||| 15 gi|2367182|gb|AE000382.1|AE000382 Escherichia coli K-12 MG1655 section 272 of 400 of the complete genome AE000382 11024 1 28.2458 14 7.44509 215 228 5427 5440 1 1 14 14 14 CGCGATCCACACGC CGCGATCCACACGC |||||||||||||| 16 gi|1789319|gb|AE000378.1|AE000378 Escherichia coli K-12 MG1655 section 268 of 400 of the complete genome AE000378 10448 1 28.2458 14 7.44509 448 435 7217 7230 1 -1 14 14 14 CGTCAGGCCATCGC CGTCAGGCCATCGC |||||||||||||| 17 gi|2367178|gb|AE000377.1|AE000377 Escherichia coli K-12 MG1655 section 267 of 400 of the complete genome AE000377 12354 1 28.2458 14 7.44509 244 257 1819 1832 1 1 14 14 14 ACGGGCATCGCCAA ACGGGCATCGCCAA |||||||||||||| 18 gi|1789011|gb|AE000351.1|AE000351 Escherichia coli K-12 MG1655 section 241 of 400 of the complete genome AE000351 10580 1 28.2458 14 7.44509 429 442 2155 2168 1 1 14 14 14 ACGGCGGCGATGGC ACGGCGGCGATGGC |||||||||||||| 19 gi|1788883|gb|AE000340.1|AE000340 Escherichia coli K-12 MG1655 section 230 of 400 of the complete genome AE000340 15169 1 28.2458 14 7.44509 404 417 2060 2073 1 1 14 14 14 CGCGGCGCTGGCCG CGCGGCGCTGGCCG |||||||||||||| 20 gi|1788870|gb|AE000339.1|AE000339 Escherichia coli K-12 MG1655 section 229 of 400 of the complete genome AE000339 10614 1 28.2458 14 7.44509 225 242 3060 3077 1 1 17 17 18 ACGCAGGATTTCGACTAC ACGCGGGATTTCGACTAC |||| ||||||||||||| 21 gi|1788605|gb|AE000317.1|AE000317 Escherichia coli K-12 MG1655 section 207 of 400 of the complete genome AE000317 20003 1 28.2458 14 7.44509 414 401 7429 7442 1 -1 14 14 14 CCAGCGCCGCGTTA CCAGCGCCGCGTTA |||||||||||||| 22 gi|2367129|gb|AE000301.1|AE000301 Escherichia coli K-12 MG1655 section 191 of 400 of the complete genome AE000301 10593 1 28.2458 14 7.44509 432 445 3587 3600 1 1 14 14 14 GCGGCGATGGCCTG GCGGCGATGGCCTG |||||||||||||| 23 gi|1788382|gb|AE000297.1|AE000297 Escherichia coli K-12 MG1655 section 187 of 400 of the complete genome AE000297 18495 1 28.2458 14 7.44509 436 449 17869 17882 1 1 14 14 14 CGATGGCCTGACGC CGATGGCCTGACGC |||||||||||||| 24 gi|1788089|gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome AE000274 13793 1 28.2458 14 7.44509 451 430 12214 12235 1 -1 20 20 22 GCGCGTCAGGCCATCGCCGCCG GCGCGTCTGGACATCGCCGCCG ||||||| || ||||||||||| 25 gi|1787955|gb|AE000262.1|AE000262 Escherichia coli K-12 MG1655 section 152 of 400 of the complete genome AE000262 10927 1 28.2458 14 7.44509 425 438 10063 10076 1 1 14 14 14 GCGCACGGCGGCGA GCGCACGGCGGCGA |||||||||||||| 26 gi|1787945|gb|AE000261.1|AE000261 Escherichia coli K-12 MG1655 section 151 of 400 of the complete genome AE000261 11033 1 28.2458 14 7.44509 465 452 9597 9610 1 -1 14 14 14 TGGAGCGTTGCGCC TGGAGCGTTGCGCC |||||||||||||| 27 gi|1787509|gb|AE000224.1|AE000224 Escherichia coli K-12 MG1655 section 114 of 400 of the complete genome AE000224 12963 1 28.2458 14 7.44509 424 437 5224 5237 1 1 14 14 14 GGCGCACGGCGGCG GGCGCACGGCGGCG |||||||||||||| 28 gi|1786782|gb|AE000162.1|AE000162 Escherichia coli K-12 MG1655 section 52 of 400 of the complete genome AE000162 10180 1 28.2458 14 7.44509 15 2 7971 7984 1 -1 14 14 14 TGCCCGCGATCGTG TGCCCGCGATCGTG |||||||||||||| 29 gi|1786728|gb|AE000158.1|AE000158 Escherichia coli K-12 MG1655 section 48 of 400 of the complete genome AE000158 10143 1 28.2458 14 7.44509 146 159 6156 6169 1 1 14 14 14 CCAGTCATTCAGAC CCAGTCATTCAGAC |||||||||||||| 30 gi|1786683|gb|AE000154.1|AE000154 Escherichia coli K-12 MG1655 section 44 of 400 of the complete genome AE000154 11519 1 28.2458 14 7.44509 378 391 953 966 1 1 14 14 14 GCACCGCCGGGCCA GCACCGCCGGGCCA |||||||||||||| 31 gi|1786501|gb|AE000138.1|AE000138 Escherichia coli K-12 MG1655 section 28 of 400 of the complete genome AE000138 10551 1 28.2458 14 7.44509 454 441 5234 5247 1 -1 14 14 14 GCCGCGCGTCAGGC GCCGCGCGTCAGGC |||||||||||||| 32 gi|1786402|gb|AE000130.1|AE000130 Escherichia coli K-12 MG1655 section 20 of 400 of the complete genome AE000130 12498 1 28.2458 14 7.44509 453 440 10651 10664 1 -1 14 14 14 CCGCGCGTCAGGCC CCGCGCGTCAGGCC |||||||||||||| 33 gi|1786250|gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome AE000117 13416 1 28.2458 14 7.44509 506 493 2140 2153 1 -1 14 14 14 CCGAGCGCGTGGCG CCGAGCGCGTGGCG |||||||||||||| 400 4662239 0 0 0.710603 1.37406 1.30725 2 lcl|2_0 coso2 409 1 gi|2367346|gb|AE000481.1|AE000481 Escherichia coli K-12 MG1655 section 371 of 400 of the complete genome AE000481 12968 1 34.1929 17 0.0931753 284 268 1023 1039 1 -1 17 17 17 CGGTGGCCCGGCGGTGC CGGTGGCCCGGCGGTGC ||||||||||||||||| 2 gi|2367291|gb|AE000456.1|AE000456 Escherichia coli K-12 MG1655 section 346 of 400 of the complete genome AE000456 11568 1 30.2282 15 1.45478 119 105 8347 8361 1 -1 15 15 15 TGCGTGTGGATCGCG TGCGTGTGGATCGCG ||||||||||||||| 3 gi|2367149|gb|AE000354.1|AE000354 Escherichia coli K-12 MG1655 section 244 of 400 of the complete genome AE000354 10404 1 30.2282 15 1.45478 131 149 9298 9316 1 1 18 18 19 ACAACGGGCATCGCCAACG ACAACGGTCATCGCCAACG ||||||| ||||||||||| 4 gi|1788763|gb|AE000330.1|AE000330 Escherichia coli K-12 MG1655 section 220 of 400 of the complete genome AE000330 10892 1 30.2282 15 1.45478 24 6 8541 8559 1 -1 18 18 19 TCGTGAACGCTCGTCCGGT TCGTGAACGCTCATCCGGT |||||||||||| |||||| 5 gi|1788498|gb|AE000307.1|AE000307 Escherichia coli K-12 MG1655 section 197 of 400 of the complete genome AE000307 10691 1 30.2282 15 1.45478 335 321 6547 6561 1 -1 15 15 15 CAGGCCATCGCCGCC CAGGCCATCGCCGCC ||||||||||||||| 6 gi|1787966|gb|AE000263.1|AE000263 Escherichia coli K-12 MG1655 section 153 of 400 of the complete genome AE000263 11684 1 30.2282 15 1.45478 259 245 1936 1950 1 -1 15 15 15 GCCGCATCGCTGTCG GCCGCATCGCTGTCG ||||||||||||||| 7 gi|1787888|gb|AE000256.1|AE000256 Escherichia coli K-12 MG1655 section 146 of 400 of the complete genome AE000256 10423 1 30.2282 15 1.45478 160 146 7051 7065 1 -1 15 15 15 ATGTGCAGCACCGTT ATGTGCAGCACCGTT ||||||||||||||| 8 gi|2367375|gb|AE000505.1|AE000505 Escherichia coli K-12 MG1655 section 395 of 400 of the complete genome AE000505 12921 1 28.2458 14 5.74837 126 113 8442 8455 1 -1 14 14 14 GAAATCCTGCGTGT GAAATCCTGCGTGT |||||||||||||| 9 gi|1790732|gb|AE000499.1|AE000499 Escherichia coli K-12 MG1655 section 389 of 400 of the complete genome AE000499 10244 1 28.2458 14 5.74837 344 331 9973 9986 1 -1 14 14 14 GCCGCGCGTCAGGC GCCGCGCGTCAGGC |||||||||||||| 10 gi|1790607|gb|AE000489.1|AE000489 Escherichia coli K-12 MG1655 section 379 of 400 of the complete genome AE000489 12088 1 28.2458 14 5.74837 319 332 1994 2007 1 1 14 14 14 ACGGCGGCGATGGC ACGGCGGCGATGGC |||||||||||||| 11 gi|2367349|gb|AE000482.1|AE000482 Escherichia coli K-12 MG1655 section 372 of 400 of the complete genome AE000482 20906 1 28.2458 14 5.74837 314 327 17124 17137 1 1 14 14 14 GGCGCACGGCGGCG GGCGCACGGCGGCG |||||||||||||| 12 gi|2367336|gb|AE000473.1|AE000473 Escherichia coli K-12 MG1655 section 363 of 400 of the complete genome AE000473 18290 1 28.2458 14 5.74837 338 351 3229 3242 1 1 14 14 14 GCGCGGCGCAACGC GCGCGGCGCAACGC |||||||||||||| 13 gi|2367315|gb|AE000460.1|AE000460 Escherichia coli K-12 MG1655 section 350 of 400 of the complete genome AE000460 10190 1 28.2458 14 5.74837 303 290 1292 1305 1 -1 14 14 14 CAGCGCCGCGTTAC CAGCGCCGCGTTAC |||||||||||||| 14 gi|2367182|gb|AE000382.1|AE000382 Escherichia coli K-12 MG1655 section 272 of 400 of the complete genome AE000382 11024 1 28.2458 14 5.74837 105 118 5427 5440 1 1 14 14 14 CGCGATCCACACGC CGCGATCCACACGC |||||||||||||| 15 gi|1789319|gb|AE000378.1|AE000378 Escherichia coli K-12 MG1655 section 268 of 400 of the complete genome AE000378 10448 1 28.2458 14 5.74837 338 325 7217 7230 1 -1 14 14 14 CGTCAGGCCATCGC CGTCAGGCCATCGC |||||||||||||| 16 gi|2367178|gb|AE000377.1|AE000377 Escherichia coli K-12 MG1655 section 267 of 400 of the complete genome AE000377 12354 1 28.2458 14 5.74837 134 147 1819 1832 1 1 14 14 14 ACGGGCATCGCCAA ACGGGCATCGCCAA |||||||||||||| 17 gi|1789011|gb|AE000351.1|AE000351 Escherichia coli K-12 MG1655 section 241 of 400 of the complete genome AE000351 10580 1 28.2458 14 5.74837 319 332 2155 2168 1 1 14 14 14 ACGGCGGCGATGGC ACGGCGGCGATGGC |||||||||||||| 18 gi|1788883|gb|AE000340.1|AE000340 Escherichia coli K-12 MG1655 section 230 of 400 of the complete genome AE000340 15169 1 28.2458 14 5.74837 294 307 2060 2073 1 1 14 14 14 CGCGGCGCTGGCCG CGCGGCGCTGGCCG |||||||||||||| 19 gi|1788870|gb|AE000339.1|AE000339 Escherichia coli K-12 MG1655 section 229 of 400 of the complete genome AE000339 10614 1 28.2458 14 5.74837 115 132 3060 3077 1 1 17 17 18 ACGCAGGATTTCGACTAC ACGCGGGATTTCGACTAC |||| ||||||||||||| 20 gi|1788605|gb|AE000317.1|AE000317 Escherichia coli K-12 MG1655 section 207 of 400 of the complete genome AE000317 20003 1 28.2458 14 5.74837 304 291 7429 7442 1 -1 14 14 14 CCAGCGCCGCGTTA CCAGCGCCGCGTTA |||||||||||||| 21 gi|2367129|gb|AE000301.1|AE000301 Escherichia coli K-12 MG1655 section 191 of 400 of the complete genome AE000301 10593 1 28.2458 14 5.74837 322 335 3587 3600 1 1 14 14 14 GCGGCGATGGCCTG GCGGCGATGGCCTG |||||||||||||| 22 gi|1788382|gb|AE000297.1|AE000297 Escherichia coli K-12 MG1655 section 187 of 400 of the complete genome AE000297 18495 1 28.2458 14 5.74837 326 339 17869 17882 1 1 14 14 14 CGATGGCCTGACGC CGATGGCCTGACGC |||||||||||||| 23 gi|1788089|gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome AE000274 13793 1 28.2458 14 5.74837 341 320 12214 12235 1 -1 20 20 22 GCGCGTCAGGCCATCGCCGCCG GCGCGTCTGGACATCGCCGCCG ||||||| || ||||||||||| 24 gi|1787955|gb|AE000262.1|AE000262 Escherichia coli K-12 MG1655 section 152 of 400 of the complete genome AE000262 10927 1 28.2458 14 5.74837 315 328 10063 10076 1 1 14 14 14 GCGCACGGCGGCGA GCGCACGGCGGCGA |||||||||||||| 25 gi|1787945|gb|AE000261.1|AE000261 Escherichia coli K-12 MG1655 section 151 of 400 of the complete genome AE000261 11033 1 28.2458 14 5.74837 355 342 9597 9610 1 -1 14 14 14 TGGAGCGTTGCGCC TGGAGCGTTGCGCC |||||||||||||| 26 gi|1787509|gb|AE000224.1|AE000224 Escherichia coli K-12 MG1655 section 114 of 400 of the complete genome AE000224 12963 1 28.2458 14 5.74837 314 327 5224 5237 1 1 14 14 14 GGCGCACGGCGGCG GGCGCACGGCGGCG |||||||||||||| 27 gi|1786728|gb|AE000158.1|AE000158 Escherichia coli K-12 MG1655 section 48 of 400 of the complete genome AE000158 10143 1 28.2458 14 5.74837 36 49 6156 6169 1 1 14 14 14 CCAGTCATTCAGAC CCAGTCATTCAGAC |||||||||||||| 28 gi|1786683|gb|AE000154.1|AE000154 Escherichia coli K-12 MG1655 section 44 of 400 of the complete genome AE000154 11519 1 28.2458 14 5.74837 268 281 953 966 1 1 14 14 14 GCACCGCCGGGCCA GCACCGCCGGGCCA |||||||||||||| 29 gi|1786501|gb|AE000138.1|AE000138 Escherichia coli K-12 MG1655 section 28 of 400 of the complete genome AE000138 10551 1 28.2458 14 5.74837 344 331 5234 5247 1 -1 14 14 14 GCCGCGCGTCAGGC GCCGCGCGTCAGGC |||||||||||||| 30 gi|1786402|gb|AE000130.1|AE000130 Escherichia coli K-12 MG1655 section 20 of 400 of the complete genome AE000130 12498 1 28.2458 14 5.74837 343 330 10651 10664 1 -1 14 14 14 CCGCGCGTCAGGCC CCGCGCGTCAGGCC |||||||||||||| 31 gi|1786250|gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome AE000117 13416 1 28.2458 14 5.74837 396 383 2140 2153 1 -1 14 14 14 CCGAGCGCGTGGCG CCGAGCGCGTGGCG |||||||||||||| 400 4662239 0 0 0.710603 1.37406 1.30725 3 lcl|3_0 coso3 1559 1 gi|2367336|gb|AE000473.1|AE000473 Escherichia coli K-12 MG1655 section 363 of 400 of the complete genome AE000473 18290 1 32.2105 16 1.44445 428 443 11645 11660 1 1 16 16 16 TATGACCGCCACCACC TATGACCGCCACCACC |||||||||||||||| 2 gi|2367252|gb|AE000440.1|AE000440 Escherichia coli K-12 MG1655 section 330 of 400 of the complete genome AE000440 15529 1 32.2105 16 1.44445 1481 1496 840 855 1 1 16 16 16 TGGTTTTCCGTTGCGA TGGTTTTCCGTTGCGA |||||||||||||||| 3 gi|1789185|gb|AE000366.1|AE000366 Escherichia coli K-12 MG1655 section 256 of 400 of the complete genome AE000366 10405 1 32.2105 16 1.44445 1389 1404 2064 2079 1 1 16 16 16 CCAGCAACGCCAGCAC CCAGCAACGCCAGCAC |||||||||||||||| 4 gi|1789783|gb|AE000414.1|AE000414 Escherichia coli K-12 MG1655 section 304 of 400 of the complete genome AE000414 11852 1 30.2282 15 5.70757 590 572 9026 9044 1 -1 18 18 19 CGTTGTCGCCGTCCCTACG CGTTGTCGCCGTCGCTACG ||||||||||||| ||||| 5 gi|2367201|gb|AE000399.1|AE000399 Escherichia coli K-12 MG1655 section 289 of 400 of the complete genome AE000399 17801 1 30.2282 15 5.70757 687 701 16498 16512 1 1 15 15 15 TCGACATCGACGAAG TCGACATCGACGAAG ||||||||||||||| 2 30.2282 15 5.70757 560 546 16612 16626 1 -1 15 15 15 AGACCACGCCGTGGC AGACCACGCCGTGGC ||||||||||||||| 6 gi|2367199|gb|AE000397.1|AE000397 Escherichia coli K-12 MG1655 section 287 of 400 of the complete genome AE000397 14820 1 30.2282 15 5.70757 701 687 13048 13062 1 -1 15 15 15 CTTCGTCGATGTCGA CTTCGTCGATGTCGA ||||||||||||||| 7 gi|2367160|gb|AE000361.1|AE000361 Escherichia coli K-12 MG1655 section 251 of 400 of the complete genome AE000361 10385 1 30.2282 15 5.70757 809 823 5707 5721 1 1 15 15 15 AAGGCTCACCACCCG AAGGCTCACCACCCG ||||||||||||||| 8 gi|1788775|gb|AE000331.1|AE000331 Escherichia coli K-12 MG1655 section 221 of 400 of the complete genome AE000331 11105 1 30.2282 15 5.70757 761 775 5621 5635 1 1 15 15 15 CGCCAGCTCCACGCC CGCCAGCTCCACGCC ||||||||||||||| 9 gi|1788709|gb|AE000325.1|AE000325 Escherichia coli K-12 MG1655 section 215 of 400 of the complete genome AE000325 12984 1 30.2282 15 5.70757 430 444 11952 11966 1 1 15 15 15 TGACCGCCACCACCT TGACCGCCACCACCT ||||||||||||||| 10 gi|1788229|gb|AE000285.1|AE000285 Escherichia coli K-12 MG1655 section 175 of 400 of the complete genome AE000285 10165 1 30.2282 15 5.70757 516 534 6253 6271 1 1 18 18 19 TCGAAAACCCTGGCGAAGA TCGAAAACCCTGACGAAGA |||||||||||| |||||| 11 gi|1788089|gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome AE000274 13793 1 30.2282 15 5.70757 833 815 7369 7387 1 -1 18 18 19 GGTGCCGCGGCGGGTGGTG GGTGACGCGGCGGGTGGTG |||| |||||||||||||| 400 4662239 0 0 0.710603 1.37406 1.30725